Questions of the Week

 

Note: Questions of the week are given at the end of labs 1, 3, 5, 6, 7, 9, 10, 12, 13, 14
 
  • Question of the Week No. 1: Mitosis
  • Answer:  Top left clockwise:  Daughter cells, Prophase, Anaphase, Metaphase, Interphase, Anaphase, 
  •                                                      Prophase. 
  • In the figure below:  Spindle fibers                   

 

  • Question of the Week No. 2: Restriction Mapping
  • Answer:  Circular.
  • In linear configuration, fragment sizes generated after digesting the DNA with BamHI must be     5505, 16841, 5626, 6527, 7233, and 6770 bp.  On the gel, the two fragments 5505 and 6770 are missing, instead a fragment of 12275 bp appears.  This is the sum of the 5505 and 6770 from the two extreme ends of the DNA, which indicates that the DNA is circular. 
  •                                                                                                      

 

  • Question of the Week No. 3:  Polymerase Chain Reaction
  • Answer:  Forward primer  5' CGATC 3'
  •                   Reverse primer  5' ATCAA 3' 

             

  •                  Deduced sequence:
  •                  5' GCTAGGCGTATGACTGTGATCTAGTATCGAACTA 3' 
  •                  3' CGATCCGCATACTGACACTAGATCATAGCTTGAT 5'

                                                                                       

 

  • Question of the Week No. 4: Cloning 1
  • Answer:                                        

                       File0002.PDFFile0002.PDF 


                 Question of the Week No. 5: Cloning 2

  • Answer:  (a) EcoRI
  •                   (b) EcoRI 
  •               (c) Kanamycin. 
  •                         Ampicillin cannot be used because when the gene of interest is inserted into the vector via the
  •                         EcoRI site, it interrupts the amp-r gene, thus destroys its function. 

 

 

  • Question of the Week No. 6: Southern blotting
  • Answer: DNA bands (in kb) visible on the gel:
  •                 HindIII digest: 7, 4, 2, 1
  •                 EcoRI digest:  7, 4, 3,
  •                 DNA bands (in kb) visible on the membrane:
  •                 HindIII digest: 7
  •                 EcoRI digest: 3

 

 

  • Question of the Week No. 7: Regulation of Gene Expression
  • Answer: Expose the plant to the UV light; trichomes should emit green-colored light.
 

 

  • Question of the Week No. 8:  Crossing Over
  • Answer:   The answer will be posted on Friday, April 18                                                                   
 

 

  • Question of the Week No. 9:  Complementation Test
  • Answer:  The answer will be posted on Friday, April 28

                                                                                                       

 

  • Question of the Week No. 10:  SSLP Mapping
  • Answer: