sA -35               sA -10

F2365       1    ATGAGGTTACTTGTTTGTTAAATGAGCGTATACCTAGAAAATACATCCATTAGAAGGTAATATTCGTGCTTTTTTTAGAAGAAGCGTTTATAATCTAACA

                 

J1-194      1    ATGAGGTTACTTGTTTGTTAAATGAGCGTATACCTAGAAAATACATCCATTAGAAGGTAATATTCGTGCTTTTTTTAGAAGAAGCGTTTATAATCTAACA

                 

10403S      1    ATGAGGTAACTTGTTTGTTAAATGAGCGCATACCTAGAAAATACATCCATTAGAAGGTAATATTCGTGCTTTTTTTAGAAGAAGCGTTTATAATCTAACA

                 

                +1

F2365       101  TATGAAACTTTATAGCTATATATAGGACTTAAGAGAGTATATCAGCTAGAACTGTAATATTCTTAACAATAAAATGCGAAATAACTCTTTTCTTCAAGGC

                  

J1-194      101  TATGAAACTTTATAGCTATATATAGGACTTAAGAGAGTATATCAGCTAGAACTGTAATATTCTTAACAATAAAATGCGAAATAACTCTTTTCTTCAAGGC

                

10403S      101  TATGAAACTTTATAGCTATATATAGGACTTAAGGGAGTATATCAGCTAGAACTGTAATATTCTTAACAATAAAATGCGAAATAACTCTTTTCTTCAAGGC

                

                          sA -10   +1                  LMOf2365_0906       

F2365       201  GTGATAATGGTACGATATAGTTGTTACTTACAGGTACGAGGCTTTGGGGGTGTGACACGTGTTAGAGAAAGAAAAGCGGATGATAATATCCGTAGAACTG

                                                                      V  L  E  K  E  K  R  M  I  I  S  V  E  L

J1-194      201  GTGATAATGGTACGATATAGTTGTTACTTACAGGTACGAGGCTTTGGGGGTGTGACACGTGTTAGAGAAAGAAAAGCGGATGATAATATCCGTAGAACTG

                                                                      V  L  E  K  E  K  R  M  I  I  S  V  E  L

10403S      201  GTGATAATGGTACGATATAGTTGTTACTTACAGGTACGAGGCTTTGGGGGTGTGACACGTGTTAGAGAAAGAAAATCGGATGATAATATCCGTAGAACTG

                                                                      V  L  E  K  E  N  R  M  I  I  S  V  E  L

 

 


F2365       301  ACACAGGAAATGATACAAGAACTCGACGTAGTTGTAGAAAAAGAAAAAATGGGGCGGAGTGAAGTTATAATGGAAGCAACGCAACAGTTTTTACAAGAGA

                  T  Q  E  M  I  Q  E  L  D  V  V  V  E  K  E  K  M  G  R  S  E  V  I  M  E  A  T  Q  Q  F  L  Q  E

J1-194      301  ACACAGGAAATGATACAAGAACTCGACGTAGTTGTAGAAAAAGAAAAAATGGGGCGGAGTGAAGTTATAATGGAAGCAACGCAACAGTTTTTACAAGAGA

                  T  Q  E  M  I  Q  E  L  D  V  V  V  E  K  E  K  M  G  R  S  E  V  I  M  E  A  T  Q  Q  F  L  Q  E

10403S      301  ACACAGGAAATGATACAAGAACTCGACGTAGTTGTAGAAAAAGAAAAAATGGGGCGGAGTGAAGTTATAATGGAAGCAACGCAACAGTTTTTACAAGAGA

                  T  Q  E  M  I  Q  E  L  D  V  V  V  E  K  E  K  M  G  R  S  E  V  I  M  E  A  T  Q  Q  F  L  Q  E

 

 


F2365       401  AAAGGGCTCGCGAATTAAGAGACGAGATGGAGCGCGGCTATGCAGAAATGGCGACAATTAATTTCGCTATCGCATGCGAGTGTACCCATGTCGAAGCAGA

                 K  R  A  R  E  L  R  D  E  M  E  R  G  Y  A  E  M  A  T  I  N  F  A  I  A  C  E  C  T  H  V  E  A  E

J1-194      401  AAAGGGCTCGCGAATTAAGAGACGAGATGGAGCGCGGCTATGCAGAAATGGCGACAATTAATTTCGCTATCGCATGCGAGTGTACCCATGTCGAAGCAGA

                 K  R  A  R  E  L  R  D  E  M  E  R  G  Y  A  E  M  A  T  I  N  F  A  I  A  C  E  C  T  H  V  E  A  E

10403S      401  AAAGGGCTCGCGAATTAAGAGACGAGATGGAACGCGGCTATGCAGAGATGGCGACAATTAATTTTGCTATCGCATGCGAGTGTACCCATGTCGAAGCAGA

                 K  R  A  R  E  L  R  D  E  M  E  R  G  Y  A  E  M  A  T  I  N  F  A  I  A  C  E  C  T  H  V  E  A  E

 

                                                            LMOf2365_0907

                                               

F2365       501  AGCAGAAGACAGGAATATTAGTATTTTAGGAGGTTAATGGCTGATGGTGAAGCGTGGTGACGTATACTACGCGGACCTTTCCCCCGTGGTCGGAAGCGAG

                   A  E  D  R  N  I  S  I  L  G  G  *        M  V  K  R  G  D  V  Y  Y  A  D  L  S  P  V  V  G  S  E

J1-194      501  AGCAGAAGACAGGAATATTAGTATTTTAGGAGGTTAATGGCTGATGGTGAAGCGTGGTGACGTATACTACGCGGACCTTTCCCCCGTGGTCGGAAGCGAG

                   A  E  D  R  N  I  S  I  L  G  G  *        M  V  K  R  G  D  V  Y  Y  A  D  L  S  P  V  V  G  S  E

10403S      501  AGCAGAAGACAGGAATATTAGTATTTTAGGAGGTTAATGGCTGATGGTGAAGCGTGGTGACGTATACTACGCGGACCTTTCCCCCGTGGTCGGAAGCGAG

                   A  E  D  R  N  I  S  I  L  G  G  *        M  V  K  R  G  D  V  Y  Y  A  D  L  S  P  V  V  G  S  E

 

 


F2365       601  CAAGGGGGAATACGGCCTGTTCTCATCATTCAAAATGATATTGGTAATAGATTCAGTCCAACTGTGATTGTGGCAGCAATAACTGCAAAAATTCAAAAAG

                  Q  G  G  I  R  P  V  L  I  I  Q  N  D  I  G  N  R  F  S  P  T  V  I  V  A  A  I  T  A  K  I  Q  K

J1-194      601  CAAGGGGGAATACGGCCTGTTCTCATCATTCAAAATGATATTGGTAATAGATTCAGTCCAACTGTGATCGTGGCAGCAATAACTGCAAAAATTCAAAAAG

                  Q  G  G  I  R  P  V  L  I  I  Q  N  D  I  G  N  R  F  S  P  T  V  I  V  A  A  I  T  A  K  I  Q  K

10403S      601  CAAGGGGGAATACGGCCTGTTCTCATCATTCAAAATGATATTGGTAATAGATTCAGTCCAACTGTGATCGTGGCAGCAATAACTGCAAAAATTCAAAAAG

                  Q  G  G  I  R  P  V  L  I  I  Q  N  D  I  G  N  R  F  S  P  T  V  I  V  A  A  I  T  A  K  I  Q  K

 

 


F2365       701  CAAAATTGCCAACACACGTGGAAGCTACTCGTAAAGATGGCTTTGAGAGAGATTCTGTCATTCTTTTAGAACAAATTAGAACGATTGACAAACAGCGCCT

                 A  K  L  P  T  H  V  E  A  T  R  K  D  G  F  E  R  D  S  V  I  L  L  E  Q  I  R  T  I  D  K  Q  R  L

J1-194      701  CAAAATTGCCAACACACGTGGAAGCTACTCGTAAAGATGGCTTTGAGAGAGATTCTGTCATTCTTTTAGAACAAATTAGAACGATTGACAAACAGCGCCT

                 A  K  L  P  T  H  V  E  A  T  R  K  D  G  F  E  R  D  S  V  I  L  L  E  Q  I  R  T  I  D  K  Q  R  L

10403S      701  CAAAATTGCCAACGCACGTGGAAGCTACTCGTAAAGATGGCTTTGAGAGAGATTCTGTCATTCTTTTAGAACAGATTAGAACGATTGATAAACAGCGCCT

                 A  K  L  P  T  H  V  E  A  T  R  K  D  G  F  E  R  D  S  V  I  L  L  E  Q  I  R  T  I  D  K  Q  R  L

 

 


F2365       801  GACAGACAAAATTACACATTTGGACGAAGATTTAATGGCCAAGGTAAACAAGGCACTTGAAGTCAGTCTAGGAGTAGTAGAATTTTAATCCATCCTAAAA

                   T  D  K  I  T  H  L  D  E  D  L  M  A  K  V  N  K  A  L  E  V  S  L  G  V  V  E  F  * 

J1-194      801  GACAGACAAAATTACACATTTGGACGAAGATTTAATGGCCAAGGTAAACAAGGCACTTGAAGTCAGTCTAGGAGTAGTAGAATTTTAATCCATCCTAAAA

                   T  D  K  I  T  H  L  D  E  D  L  M  A  K  V  N  K  A  L  E  V  S  L  G  V  V  E  F  * 

10403S      801  GACAGATAAAATTACGCATTTGGACGAAGATTTAATGGCCAAGGTAAACAAGGCACTTGAAGTCAGTCTAGGAGTAGTAGAATTTTAATCCATCCTAAAA

                   T  D  K  I  T  H  L  D  E  D  L  M  A  K  V  N  K  A  L  E  V  S  L  G  V  V  E  F  * 

 


                                                                             +1

F2365       901  AA--TAACATACAATGATGAATGCAGGACAAAAGGGTCTGACGTAAAATAATAAGTTTAATACATAATGAAATAATTAACTGCTCTGAAGAAACAGTAAG

                 

J1-194      901  AA--TAACATACAATGATGAATGCAGGACAAAAGGGTCTGACGTAAAATAATAAGTTTAATACATAATGAAATAATTAACTGCTCTGAAGAAACAGTAAG

                 

10403S      901  AAAATAACATAAAATGATGAATGCAGGGCAAAAGGGTCTGACGTAAAATAATTAGTTTAATACATAATGAAATAGTTAACTGCTCTGAAGAAACAGTAAG

                 

 

 

F2365       999  GACATCAGAAACCTACAAACAACGCGTATCAACATACTCGCTAAATTTGTTTCTAATGTCTTTTTTAAAAGGCAGTTAAGCAAACCGCACAATAAGAGAG

                  

J1-194      999  GACATCAGAAACCTACAAACAACGCGTATCAACATACTCGCTAAATTTGTTTCTAATGTCTTTTTTAAAAGGCAGTTAAGCAAACCGCACAATAAGAGAG

                    

10403S      1001 GACATCAGAAACCTACAAACAACGCGTATCAACATACTCGCTAAATTTGTTTCTAATGTCTTTTTTAAAAGGCAGTTAAGCAAACCGCACAATAAGAGAG

                

 

 

                                                    rsbR

F2365       1099 AAAATTTTGTTAATAGTGGAGAAAGGTTGGAAAATAACTGATGTATAAAGATTTTGCAAACTTCATCCGTACAAATAAAGCAGACTTACTAAACAACTGG

                                                          M  Y  K  D  F  A  N  F  I  R  T  N  K  A  D  L  L  N  N  W

J1-194      1099 AAAATTTTGTTAATAGTGGAGAAAGGTTGGAAAATAACTGATGTATAAAGATTTTGCAAACTTCATCCGTACAAATAAAGCAGACTTACTGAATGACTGG

                                                          M  Y  K  D  F  A  N  F  I  R  T  N  K  A  D  L  L  N  D  W

10403S      1101 AAAATTTTGTTAATAGTGGAGAAAGGTTGGAAAATAACTGATGTATAAAGATTTTGCAAACTTCATCCGTACAAATAAAGCAGACTTACTGAATGACTGG

                                                          M  Y  K  D  F  A  N  F  I  R  T  N  K  A  D  L  L  N  D  W

 

 


F2365       1199 ATGAATGAAATGGAAAAACAATCAGATCAGCTAATCAACGACATTGCAAAAGAAGCAATGTACGAAGAAACTAGCAAAGAATTTGTGGATTTAATTGTTT

                  M  N  E  M  E  K  Q  S  D  Q  L  I  N  D  I  A  K  E  A  M  Y  E  E  T  S  K  E  F  V  D  L  I  V 

J1-194      1199 ATGAACGAAATGGAGAAACAATCAGATCAGCTAATCAATGACATTGCAAAAGAAGCAATGTACGAAGAAACTAGCAAAGAATTTGTAGATTTAATTGTTT

                  M  N  E  M  E  K  Q  S  D  Q  L  I  N  D  I  A  K  E  A  M  Y  E  E  T  S  K  E  F  V  D  L  I  V 

10403S      1201 ATGAACGAAATGGAGAAACAATCAGATCAGCTAATCAATGACATTGCAAAAGAAGCAATGTACGAAGAAACTAGCAAAGAATTTGTAGATTTAATTGTTT

                  M  N  E  M  E  K  Q  S  D  Q  L  I  N  D  I  A  K  E  A  M  Y  E  E  T  S  K  E  F  V  D  L  I  V

 

 


F2365       1299 CGAATGTAACTGAAAACGGCTCTAAATTCAACGAAAAACTAGATGATTTTGCAGAGAAAGTGGTCCACCTAGGTTGGCCGATTCATTTTGTTACCACTGG

                 S  N  V  T  E  N  G  S  K  F  N  E  K  L  D  D  F  A  E  K  V  V  H  L  G  W  P  I  H  F  V  T  T  G

J1-194      1299 CGAATGTAACTGAAAACGGTTCTAAGTTCAACGAAAAACTAGATGATTTTGCAGAGAAAGTGGTCCACCTAGGTTGGCCGATTCATTTTGTTACCACTGG

                 S  N  V  T  E  N  G  S  K  F  N  E  K  L  D  D  F  A  E  K  V  V  H  L  G  W  P  I  H  F  V  T  T  G

10403S      1301 CGAATGTTACAGAAAACGGTTCTAAATTCAACGAAAAACTAGATGATTTTGCAGAAAAAGTGGTCCACCTCGGTTGGCCAATTCATTTTGTTACCACGGG

                 S  N  V  T  E  N  G  S  K  F  N  E  K  L  D  D  F  A  E  K  V  V  H  L  G  W  P  I  H  F  V  T  T  G

 

 


F2365       1399 CCTACGTGTTTTTGGGCTTTTAGTATATACAGCAATGAGAGATGAAGATTTATTTTTAAAGAGAGAAGAAAAACCTGAAGATGATGCCTATTATCGCTTT

                   L  R  V  F  G  L  L  V  Y  T  A  M  R  D  E  D  L  F  L  K  R  E  E  K  P  E  D  D  A  Y  Y  R  F

J1-194      1399 CCTACGTGTTTTTGGGCTTTTAGTATATACAGCAATGAGAGATGAAGATTTATTTTTAAAGAGAGAAGAAAAACCTGAAGATGATGCCTATTATCGCTTT

                   L  R  V  F  G  L  L  V  Y  T  A  M  R  D  E  D  L  F  L  K  R  E  E  K  P  E  D  D  A  Y  Y  R  F

10403S      1401 CCTGCGTGTTTTTGGGCTTTTAGTATATACAGCAATGAGAGATGAAGATCTATTCTTAAAAAGAGAAGAAAAACCTGAAGATGATGCCTATTATCGCTTT

                   L  R  V  F  G  L  L  V  Y  T  A  M  R  D  E  D  L  F  L  K  R  E  E  K  P  E  D  D  A  Y  Y  R  F

 

 


F2365       1499 GAAACATGGCTTTCCTCCATGTATAACAAAGTGGTCACAGCCTACGCGGATACGTGGGAAAAGACAGTTTCTATCCAAAAAAGTGCACTACAGGAATTAT

                  E  T  W  L  S  S  M  Y  N  K  V  V  T  A  Y  A  D  T  W  E  K  T  V  S  I  Q  K  S  A  L  Q  E  L 

J1-194      1499 GAAACATGGCTTTCCTCCATGTATAACAAAGTGGTCACAGCCTACGCGGATACGTGGGAAAAGACAGTTTCTATCCAAAAAAGTGCACTACAGGAATTAT

                  E  T  W  L  S  S  M  Y  N  K  V  V  T  A  Y  A  D  T  W  E  K  T  V  S  I  Q  K  S  A  L  Q  E  L 

10403S      1501 GAAACATGGCTTTCGTCCATGTACAACAAAGTGGTCACTGCCTACGCGGATACGTGGGAAAAGACAGTTTCTATCCAAAAAAGTGCTTTACAGGAATTAT

                  E  T  W  L  S  S  M  Y  N  K  V  V  T  A  Y  A  D  T  W  E  K  T  V  S  I  Q  K  S  A  L  Q  E  L

 

 


F2365       1599 CGGCACCACTTTTGCCAATATTTGAAAAAATTTCTGTAATGCCGTTAATTGGGACGATTGACACGGAAAGAGCCAAGTTAATCATAGAAAATTTATTAAT

                S  A  P  L  L  P  I  F  E  K  I  S  V  M  P  L  I  G  T  I  D  T  E  R  A  K  L  I  I  E  N  L  L  I

J1-194      1599 CGGCACCACTTTTGCCAATATTTGAAAAAATTTCTGTAATGCCGTTAATTGGGACGATTGACACGGAAAGAGCCAAGTTAATCATAGAAAATTTATTAAT

                S  A  P  L  L  P  I  F  E  K  I  S  V  M  P  L  I  G  T  I  D  T  E  R  A  K  L  I  I  E  N  L  L  I

10403S      1601 CTGCACCACTTTTACCAATATTTGAAAAAATTTCTGTAATGCCGTTAATTGGAACGATTGACACAGAAAGAGCCAAGTTAATCATAGAAAACTTACTAAT

                 S  A  P  L  L  P  I  F  E  K  I  S  V  M  P  L  I  G  T  I  D  T  E  R  A  K  L  I  I  E  N  L  L  I

 

 


F2365       1699 AGGTGTTGTAAAAAATCGGTCAGAAGTGGTTTTGATTGATATTACGGGAGTTCCTGTTGTTGATACAATGGTTGCGCACCATATTATTCAAGCGTCCGAA

                   G  V  V  K  N  R  S  E  V  V  L  I  D  I  T  G  V  P  V  V  D  T  M  V  A  H  H  I  I  Q  A  S  E

J1-194      1699 AGGTGTTGTAAAAAATCGGTCAGAAGTGGTTTTGATTGATATTACGGGAGTTCCTGTTGTTGATACAATGGTTGCGCACCATATTATTCAAGCGTCCGAA

                   G  V  V  K  N  R  S  E  V  V  L  I  D  I  T  G  V  P  V  V  D  T  M  V  A  H  H  I  I  Q  A  S  E

10403S      1701 AGGTGTTGTAAAAAATCGGTCAGAAGTGGTTTTGATTGATATTACGGGAGTTCCTGTTGTTGATACAATGGTTGCGCACCATATTATTCAAGCGTCCGAA

                   G  V  V  K  N  R  S  E  V  V  L  I  D  I  T  G  V  P  V  V  D  T  M  V  A  H  H  I  I  Q  A  S  E

 

 


F2365       1799 GCGGTTAGACTTGTCGGCTGTCAGGCGATGCTTGTAGGTATTAGACCAGAAATCGCGCAAACAATCGTTAACTTAGGAATTGAATTAGATCAAATTATCA

                  A  V  R  L  V  G  C  Q  A  M  L  V  G  I  R  P  E  I  A  Q  T  I  V  N  L  G  I  E  L  D  Q  I  I 

J1-194      1799 GCGGTTAGACTTGTCGGCTGTCAGGCGATGCTTGTAGGTATTAGACCAGAAATCGCGCAAACAATCGTTAACTTAGGAATTGAATTAGATCAAATTATCA

                  A  V  R  L  V  G  C  Q  A  M  L  V  G  I  R  P  E  I  A  Q  T  I  V  N  L  G  I  E  L  D  Q  I  I 

10403S      1801 GCAGTTAGACTTGTCGGCTGTCAGGCAATGCTTGTAGGTATTAGACCAGAAATCGCGCAAACAATCGTTAACTTAGGAATTGAATTAGATCAAATTATCA

                  A  V  R  L  V  G  C  Q  A  M  L  V  G  I  R  P  E  I  A  Q  T  I  V  N  L  G  I  E  L  D  Q  I  I

 

                                                                                              rsbS

F2365       1899 CGACCAACACAATGAAAAAAGGCATGGAGCGTGCGCTAGCCTTGACGAACAGAGAGATAGTAGAAAAAGAGGGGTGAATACTGTGGGGATACCAATCTTA

                 T  T  N  T  M  K  K  G  M  E  R  A  L  A  L  T  N  R  E  I  V  E  K  E  G  *       V  G  I  P  I  L

J1-194      1899 CGACCAACACAATGAAAAAAGGCATGGAGCGTGCGCTAGCCTTGACGAACAGAGAGATAGTAGAAAAAGAGGGGTGAATACTGTGGGGATACCAATCTTA

                 T  T  N  T  M  K  K  G  M  E  R  A  L  A  L  T  N  R  E  I  V  E  K  E  G  *       V  G  I  P  I  L

10403S      1901 CTACCAACACAATGAAAAAAGGCATGGAGCGTGCGCTAGCCTTGACGAACAGAGAGATAGTAGAAAAAGAGGGGTGAATACTGTGGGGATACCAATCTTA

                 T  T  N  T  M  K  K  G  M  E  R  A  L  A  L  T  N  R  E  I  V  E  K  E  G  *       V  G  I  P  I  L 

 

 


F2365       1999 AAGTTAGGTGAATGTTTATTAATTTCTATCCAGAGTGAATTAGATGATCATACTGCGGTAGAATTCCAGGAAGATTTGCTTGCAAAAATCCATGAAACGT

                  K  L  G  E  C  L  L  I  S  I  Q  S  E  L  D  D  H  T  A  V  E  F  Q  E  D  L  L  A  K  I  H  E  T

J1-194      1999 AAGTTAGGTGAATGTTTATTAATTTCTATCCAGAGTGAATTAGATGATCATACTGCGGTAGAATTCCAGGAAGATTTGCTTGCAAAAATCCATGAAACGT

                  K  L  G  E  C  L  L  I  S  I  Q  S  E  L  D  D  H  T  A  V  E  F  Q  E  D  L  L  A  K  I  H  E  T

10403S      2001 AAGTTAGGTGAATGTTTATTAATTTCTATCCAGAGTGAATTAGATGATCATACTGCGGTAGAATTCCAGGAAGATTTGCTTGCAAAAATCCATGAAACGT

                  K  L  G  E  C  L  L  I  S  I  Q  S  E  L  D  D  H  T  A  V  E  F  Q  E  D  L  L  A  K  I  H  E  T 

 

 


F2365       2099 CGGCCAGAGGAGTAGTCATTGATATAACTTCCATCGATTTTATTGATTCATTTATTGCAAAAATTCTTGGAGATGTAGTAAGTATGTCTAAACTAATGGG

                 S  A  R  G  V  V  I  D  I  T  S  I  D  F  I  D  S  F  I  A  K  I  L  G  D  V  V  S  M  S  K  L  M  G

J1-194      2099 CGGCCAGAGGAGTAGTCATTGATATAACTTCCATCGATTTTATTGATTCATTTATTGCAAAAATTCTTGGAGATGTAGTAAGTATGTCTAAACTAATGGG

                 S  A  R  G  V  V  I  D  I  T  S  I  D  F  I  D  S  F  I  A  K  I  L  G  D  V  V  S  M  S  K  L  M  G

10403S      2101 CGGCCAGAGGAGTAGTCATTGATATAACTTCTATCGATTTTATTGATTCATTTATTGCAAAAATTCTTGGAGATGTAGTAAGTATGTCTAAACTAATGGG

                 S  A  R  G  V  V  I  D  I  T  S  I  D  F  I  D  S  F  I  A  K  I  L  G  D  V  V  S  M  S  K  L  M  G

 

 


F2365       2199 TGCAAAAGTGGTTGTAACTGGGATACAGCCAGCAGTTGCGATTACACTAATTGAACTCGGAATTACGTTTAGCGGAGTACTTTCGGCGATGGACCTTGAA

                   A  K  V  V  V  T  G  I  Q  P  A  V  A  I  T  L  I  E  L  G  I  T  F  S  G  V  L  S  A  M  D  L  E

J1-194      2199 TGCAAAAGTGGTTGTAACTGGGATACAGCCAGCAGTTGCGATTACACTAATTGAACTCGGAATTACGTTTAGCGGAGTACTTTCGGCGATGGACCTTGAA

                   A  K  V  V  V  T  G  I  Q  P  A  V  A  I  T  L  I  E  L  G  I  T  F  S  G  V  L  S  A  M  D  L  E

10403S      2201 TGCAAAAGTGGTTGTAACTGGGATACAGCCAGCAGTTGCGATTACACTAATTGAACTCGGAATTACGTTTAGCGGAGTACTTTCGGCGATGGACCTTGAA

                   A  K  V  V  V  T  G  I  Q  P  A  V  A  I  T  L  I  E  L  G  I  T  F  S  G  V  L  S  A  M  D  L  E

 

                                                     rsbT

 

F2365       2299 AGTGGTCTGGAAAAACTTAAACAGGAATTGGGGGAATGAACATGACATTCCAATCCTGTGTAAAGATAATTAATGAATGGGACATTGTAGCTGCTAGGCA

                  S  G  L  E  K  L  K  Q  E  L  G  E  *

                                                M  N  M  T  F  Q  S  C  V  K  I  I  N  E  W  D  I  V  A  A  R  Q

J1-194      2299 AGTGGTCTGGAAAAACTTAAACAGGAATTGGGGGAATGAACATGACATTCCAATCCTGTGTAAAGATAATTAATGAATGGGACATTGTAGCTGCTAGGCA

                  S  G  L  E  K  L  K  Q  E  L  G  E  * 

                                                M  N  M  T  F  Q  S  C  V  K  I  I  N  E  W  D  I  V  A  A  R  Q

10403S      2301 AGTGGTCTGGAAAAACTTAAACAGGAATTGGGGGAATGAACATGACATTCCAATCCTGTGTAAAGATAATTAATGAATGGGATATTGTAGCTGCAAGGCA

                  S  G  L  E  K  L  K  Q  E  L  G  E  *

                                                M  N  M  T  F  Q  S  C  V  K  I  I  N  E  W  D  I  V  A  A  R  Q

 

 


F2365       2399 ACTAGGTAGAAAAATATCTAAAGAAATTGGCTTTGGAACCGTTGACCAAGCAAGAATTACAACTGCCATCAGTGAATTAGCTAGAAATATTTTCCTTTAT

                   L  G  R  K  I  S  K  E  I  G  F  G  T  V  D  Q  A  R  I  T  T  A  I  S  E  L  A  R  N  I  F  L  Y 

J1-194      2399 ACTAGGTAGAAAAATATCCAAAGAAATTGGCTTTGGAACCGTTGACCAAGCAAGAATTACAACTGCCATCAGTGAATTAGCTAGAAATATTTTCCTTTAT

                   L  G  R  K  I  S  K  E  I  G  F  G  T  V  D  Q  A  R  I  T  T  A  I  S  E  L  A  R  N  I  F  L  Y 

10403S      2401 ACTAGGTAGAAAAATATCCAAAGAAATTGGCTTTGGAACCGTTGACCAAGCAAGAATTACAACTGCCATCAGTGAATTAGCTAGAAATATTTTCCTTTAT

                   L  G  R  K  I  S  K  E  I  G  F  G  T  V  D  Q  A  R  I  T  T  A  I  S  E  L  A  R  N  I  F  L  Y

 

 


F2365       2499 GCTGGACGAGGAGAAATCTGTATCGAAAAAGTAAATGAATCTGGTAAACAAGGGATGATTATTGTTGCCAAAGACAAAGGTCCAGGTATTGTAGACATAA

                 A  G  R  G  E  I  C  I  E  K  V  N  E  S  G  K  Q  G  M  I  I  V  A  K  D  K  G  P  G  I  V  D  I 

J1-194      2499 GCTGGACGAGGAGAAATCTGTATCGAAAAAGTAAATGAATCTGGTAAACAAGGGATGATTATTGTTGCCAAAGACAAAGGTCCAGGTATTGTAGACATAA

                 A  G  R  G  E  I  C  I  E  K  V  N  E  S  G  K  Q  G  M  I  I  V  A  K  D  K  G  P  G  I  V  D  I 

10403S      2501 GCTGGACGAGGAGAAATCTGTATCGAAAAAGTAAGTGAATCTGGTAAACAAGGTATGATTATTGTTGCCAAAGACAAAGGTCCAGGTATTGTAGACATAA

                  A  G  R  G  E  I  C  I  E  K  V  S  E  S  G  K  Q  G  M  I  I  V  A  K  D  K  G  P  G  I  V  D  I 

 

 


F2365       2599 GAAAAGTAATGCAAGATGGTTATACAACATCGGGCGGACTTGGAGCAGGGCTTCCAGGAGTCAAACGTTTAATGGACAGTTTTGATATTGAATCCAGTAT

                 R  K  V  M  Q  D  G  Y  T  T  S  G  G  L  G  A  G  L  P  G  V  K  R  L  M  D  S  F  D  I  E  S  S  I

J1-194      2599 GAAAAGTAATGCAAGATGGTTATACAACATCGGGCGGACTTGGAGCAGGGCTTCCAGGAGTCAAACGTTTAATGGACAGTTTTGATATTGAATCCAGTAT

                 R  K  V  M  Q  D  G  Y  T  T  S  G  G  L  G  A  G  L  P  G  V  K  R  L  M  D  S  F  D  I  E  S  S  I

10403S      2601 GAAAAGTAATGCAAGATGGTTATACAACATCAGGTGGTCTTGGAGCAGGTCTTCCAGGAGTCAAACGTTTAATGGACAGTTTTGATATTGAATCCAGTAT

                 R  K  V  M  Q  D  G  Y  T  T  S  G  G  L  G  A  G  L  P  G  V  K  R  L  M  D  S  F  D  I  E  S  S  I

 

                                                                                rsbU

F2365       2699 TGAAGGCGATTCTAAAGGAACGGTAATTACAACAACGAAATGGGTTCGGTAAGGAGAGCTAGAAAAAAATGGAAAAAGCTTTTGAGGGAAAATACCGTGA

                   E  G  D  S  K  G  T  V  I  T  T  T  K  W  V  R  *                  M  E  K  A  F  E  G  K  Y  R  D

J1-194      2699 TGAAGGCGATTCTAAAGGAACGGTAATTACAACAACGAAATGGGTTCGGTAAGGAGAGCTAGAAAAAAATGGAAAAAGCTTTTGAGGGAAAATACCGTGA

                   E  G  D  S  K  G  T  V  I  T  T  T  K  W  V  R  *                  M  E  K  A  F  E  G  K  Y  R  D

10403S      2701 TGAAGGCGATTCTAAAGGAACGGTAATTACAACAACGAAATGGGTTCGGTAAGGAGAGCTAGAAAAAAATGGAAAAAGCTTTTGAGGGAAAATACCGTGA

                   E  G  D  S  K  G  T  V  I  T  T  T  K  W  V  R  *                  M  E  K  A  F  E  G  K  Y  R  D

 

 


F2365       2799 TATTCTTATTCAGTATTTAGAACATCAAGATGAAGAAATTCTTTATACTTGCGAAAAATTATCCAGAGAAGCTATGGAAGAGCGAGTATCACCAGAAGAA

                   I  L  I  Q  Y  L  E  H  Q  D  E  E  I  L  Y  T  C  E  K  L  S  R  E  A  M  E  E  R  V  S  P  E  E

J1-194      2799 TATTCTTATTCAGTATTTAGAACATCAAGATGAAGAAATTCTTTATACTTGCGAAAAATTATCCAGAGAAGCTATGGAAGAGCGAGTATCACCAGAAGAA

                   I  L  I  Q  Y  L  E  H  Q  D  E  E  I  L  Y  T  C  E  K  L  S  R  E  A  M  E  E  R  V  S  P  E  E

10403S      2801 TATTCTTATTCAATATTTAGAACATCAAGATGAAGAAATTCTTTATACTTGCGAAAAATTATCCAGAGAAGCTATGGAAGAACGAGTATCACCAGAAGAA

                   I  L  I  Q  Y  L  E  H  Q  D  E  E  I  L  Y  T  C  E  K  L  S  R  E  A  M  E  E  R  V  S  P  E  E

 

 


F2365       2899 ATTGTCCATTTACATCGCTCGGTTCTTGAACTATACGGAAAAGAGTTGCCGGATTTTGTACGATTATCATTTGATGTACTACTAGAAATAATGGTAGGCT

                  I  V  H  L  H  R  S  V  L  E  L  Y  G  K  E  L  P  D  F  V  R  L  S  F  D  V  L  L  E  I  M  V  G

J1-194      2899 ATTGTCCATTTACATCGCTCGGTTCTTGAACTATACGGAAAAGAGTTGCCGGATTTTGTACGATTATCATTTGATGTACTACTAGAAATAATGGTAGGCT

                  I  V  H  L  H  R  S  V  L  E  L  Y  G  K  E  L  P  D  F  V  R  L  S  F  D  V  L  L  E  I  M  V  G

10403S      2901 ATTGTCCATTTACATCGCTCGGTTCTTGAACTATACGGAAAAGAGTTGCCGGATTTTGTCCGATTATCATTTGATGTACTACTTGAAATAATGGTAGGCT

                  I  V  H  L  H  R  S  V  L  E  L  Y  G  K  E  L  P  D  F  V  R  L  S  F  D  V  L  L  E  I  M  V  G

 

 

F2365       2999 ACGGCTTAGCTTATATGGAGCATCTTAGTCTAAGAACCGAGCAAAAAGAATTACGTAGTGAAATCGCTCAAGCAGAAGATATGCAAAAAACGTTAATGAA

                 Y  G  L  A  Y  M  E  H  L  S  L  R  T  E  Q  K  E  L  R  S  E  I  A  Q  A  E  D  M  Q  K  T  L  M  K

J1-194      2999 ACGGCTTAGCTTATATGGAGCATCTTAGTCTAAGAACCGAGCAAAAAGAATTACGTAGTGAAATCGCTCAAGCAGAAGATATGCAAAAAACGTTAATGAA

                 Y  G  L  A  Y  M  E  H  L  S  L  R  T  E  Q  K  E  L  R  S  E  I  A  Q  A  E  D  M  Q  K  T  L  M  K

10403S      3001 ACGGCTTGGCTTATATGGAACATCTTAGTCTAAGAACCGAGCAAAAAGAATTACGTAGTGAAATTGCTCAAGCGGAAGATATGCAAAAAACGTTAATGAA

                 Y  G  L  A  Y  M  E  H  L  S  L  R  T  E  Q  K  E  L  R  S  E  I  A  Q  A  E  D  M  Q  K  T  L  M  K

 

 


F2365       3099 AACAGAGGTACCGGAACACGATGAACTTGATTTTGGAGTTATTAGCGTCGCAGCTAGACAAATGAGCGGTGACTACTATAGCTTTACAGAAGAAGGTGAC

                   T  E  V  P  E  H  D  E  L  D  F  G  V  I  S  V  A  A  R  Q  M  S  G  D  Y  Y  S  F  T  E  E  G  D

J1-194      3099 AACAGAGGTACCGGAACACGATGAACTTGATTTTGGAGTTATTAGCGTCGCAGCTAGACAAATGAGCGGTGACTACTATAGCTTTACAGAAGAAGGTGAC

                   T  E  V  P  E  H  D  E  L  D  F  G  V  I  S  V  A  A  R  Q  M  S  G  D  Y  Y  S  F  T  E  E  G  D

10403S      3101 AACAGAGGTACCGGAACACGATGAACTTGATTTTGGGGTTATCAGTGTCGCTGCCAGACAAATGAGCGGTGATTACTATAGCTTTACAGAAGAAGGCGAC

                   T  E  V  P  E  H  D  E  L  D  F  G  V  I  S  V  A  A  R  Q  M  S  G  D  Y  Y  S  F  T  E  E  G  D 

 

 


F2365       3199 AAACAAATTGGTATCGCGCTTGCTGATGTTATTGGTAAAGGAATTCCAGCCGCATTTAGTATTTCCATGATAAAATACGCACTAGCTGGAATGACTGGGG

                  K  Q  I  G  I  A  L  A  D  V  I  G  K  G  I  P  A  A  F  S  I  S  M  I  K  Y  A  L  A  G  M  T  G

J1-194      3199 AAACAAATTGGTATCGCGCTTGCTGATGTTATTGGTAAAGGAATTCCAGCCGCATTTAGTATTTCCATGATAAAATACGCACTAGCTGGAATGACTGGGG

                  K  Q  I  G  I  A  L  A  D  V  I  G  K  G  I  P  A  A  F  S  I  S  M  I  K  Y  A  L  A  G  M  T  G

10403S      3201 AAACAAATTGGTATCGCTCTTGCTGATGTTATTGGTAAAGGAATTCCAGCCGCATTTAGTATTTCCATGATAAAATACGCACTAGCTGGAATGACAGGGG

                  K  Q  I  G  I  A  L  A  D  V  I  G  K  G  I  P  A  A  F  S  I  S  M  I  K  Y  A  L  A  G  M  T  G 

 

 


F2365       3299 ACGACAGAAAACCATCTATCGTACTCGAATCATTAAACCAAGTAGCAGAAGAAAATATTAACGACAATATGTTTATCACGATGTTTTACGGGCTTTATCA

                 D  D  R  K  P  S  I  V  L  E  S  L  N  Q  V  A  E  E  N  I  N  D  N  M  F  I  T  M  F  Y  G  L  Y  H

J1-194      3299 ACGACAGAAAACCATCTATCGTACTCGAATCATTAAACCAAGTAGCAGAAGAAAATATTAACGACAATATGTTTATCACGATGTTTTACGGGCTTTATCA

                 D  D  R  K  P  S  I  V  L  E  S  L  N  Q  V  A  E  E  N  I  N  D  N  M  F  I  T  M  F  Y  G  L  Y  H

10403S      3301 ACGACAGAAAACCATCTATTGTACTCGAATCATTAAACCAAGTAGCGGAAGAAAATATTAACGACAACATGTTTATCACGATGTTTTACGGGCTCTATCA

                 D  D  R  K  P  S  I  V  L  E  S  L  N  Q  V  A  E  E  N  I  N  D  N  M  F  I  T  M  F  Y  G  L  Y  H

 

 


F2365       3399 CGAAGATACACATTTGTTTGAATATGGTTCAGCCGGACATGAACTGGGCTTATATTACCAACATAAAGAAAACAGCTTTTCTGATTTATACGCCAAAGGT

                   E  D  T  H  L  F  E  Y  G  S  A  G  H  E  L  G  L  Y  Y  Q  H  K  E  N  S  F  S  D  L  Y  A  K  G

J1-194      3399 CGAAGATACACATTTGTTTGAATATGGTTCAGCCGGACATGAACTGGGCTTATATTACCAACATAAAGAAAACAGCTTTTCTGATTTATACGCCAAAGGT

                   E  D  T  H  L  F  E  Y  G  S  A  G  H  E  L  G  L  Y  Y  Q  H  K  E  N  S  F  S  D  L  Y  A  K  G

10403S      3401 CGAAGATACACATTTGTTTGAATATGGTTCAGCAGGACATGAGCTGGGCTTATATTACCAGCATAAAGAAAACAGCTTTTCTGATTTATACGCCAAAGGC

                   E  D  T  H  L  F  E  Y  G  S  A  G  H  E  L  G  L  Y  Y  Q  H  K  E  N  S  F  S  D  L  Y  A  K  G

 

 


F2365       3499 TTACCACTGGGTGTAGATAAAAATGCTGTCTACCGTCAATTTGATAAGAAAATTGAAGTGGGGGACGCTATATTTATTATGTCAGATGGTGTAACAGAAA

                  L  P  L  G  V  D  K  N  A  V  Y  R  Q  F  D  K  K  I  E  V  G  D  A  I  F  I  M  S  D  G  V  T  E

J1-194      3499 TTACCACTGGGTGTAGATAAAAATGCTGTCTACCGTCAATTTGATAAGAAAATTGAAGTGGGGGACGCTATATTTATTATGTCAGATGGTGTAACAGAAA

                  L  P  L  G  V  D  K  N  A  V  Y  R  Q  F  D  K  K  I  E  V  G  D  A  I  F  I  M  S  D  G  V  T  E

10403S      3501 TTACCACTGGGTGTGGATAAAAATGCTATCTACCGTCAATTTGATAAGAAAATTGAAGTGGGGGATGCTGTATTTATTATGTCAGATGGTGTAACAGAAA

                  L  P  L  G  V  D  K  N  A  I  Y  R  Q  F  D  K  K  I  E  V  G  D  A  V  F  I  M  S  D  G  V  T  E  

 

 


F2365       3599 CAAGAACAGCCAATGGTTTTCTTGAACGTGAAGAGTTAACAGAAATTATAGCAGCGCATATTTCATTATCTGCTGAAAAAATGGTTCATGCGATTTATGA

                 T  R  T  A  N  G  F  L  E  R  E  E  L  T  E  I  I  A  A  H  I  S  L  S  A  E  K  M  V  H  A  I  Y  D

J1-194      3599 CAAGAACAGCCAATGGTTTTCTTGAACGTGAAGAGTTAACAGAAATTATAGCAGCGCATATTTCATTATCTGCTGAAAAAATGGTTCATGCGATTTATGA

                 T  R  T  A  N  G  F  L  E  R  E  E  L  T  E  I  I  A  A  H  I  S  L  S  A  E  K  M  V  H  A  I  Y  D

10403S      3601 CAAGAACAGCCAATGGCTTTATTGAACGTGAAGAGTTAACAGAAATTATAGCAGCGCATATTTCATTATCTGCTGAAAAAATGGTTCATGCAATTTATGA

                 T  R  T  A  N  G  F  I  E  R  E  E  L  T  E  I  I  A  A  H  I  S  L  S  A  E  K  M  V  H  A  I  Y  D

 

 


F2365       3699 TCAATTAGTTAAAATGCAAAACTTTGAGTTGCATGATGACTTTACGCTTATTTGTATTAAGCGAACTAAATAAGAAGAAGTGAAGACGTACCTCATTCTT

                   Q  L  V  K  M  Q  N  F  E  L  H  D  D  F  T  L  I  C  I  K  R  T  K  * 

J1-194      3699 TCAATTAGTTAAAATGCAAAACTTTGAGTTGCATGATGACTTTACGCTTATTTGTATTAAGCGAACTAAATAAGAAGAAGTGAAGACGTACCTCATTCTT

                   Q  L  V  K  M  Q  N  F  E  L  H  D  D  F  T  L  I  C  I  K  R  T  K  * 

10403S      3701 TCAATTAGTTAAAATGCAAAACTTTGAGTTGCATGATGACTTTACGCTTATTTGTATTAAGCGAACTAAATAAGAAGAAGTGAAGACGTACCTCATTCTT

                   Q  L  V  K  M  Q  N  F  E  L  H  D  D  F  T  L  I  C  I  K  R  T  K  *

 

                                                                      sB -35              sB -10

F2365       3799 TAGAGAGCATTTACTGGTGAGTAAACGTATTTAAAGAGTGGAGCGTTTTTATTTTTGAATGTTTTAATTTTATTAGTTAGGGTAAAATCGACAGTATACT

                 

J1-194      3799 TAGAGAGCATTTACTGGTGAGTAAACGTATTTAAAGAGTGGAGCGTTTTTATTTTTGAATGTTTTAATTTTATTAGTTAGGGTAAAATCGACAGTATACT

                 

10403S      3801 TAGAGAGCATTTACTGGTGAGTAAACGTATTTAAAGAGTGGAGCGTTTTTATTTTTGAATGTTTTAATTTTATTAGTTAGGGTAAAATCGACAGTATACT

                   

 

                                  rsbV

F2365       3899 TAAAATTAGATGGGGTGAAGTGATGAATATTAGTATAGAAATAAAAGAACGTGATACTGACCACATAGACATATTTGTTGCTGGGGAGATCGATGCTTAT

                                        M  N  I  S  I  E  I  K  E  R  D  T  D  H  I  D  I  F  V  A  G  E  I  D  A  Y 

J1-194      3899 TAAAATTAGATGGGGTGAAGTGATGAATATTAGTATAGAAATAAAAGAACGTGATACTGACCACATAGACATATTTGTTGCTGGGGAGATCGATGCTTAT

                                        M  N  I  S  I  E  I  K  E  R  D  T  D  H  I  D  I  F  V  A  G  E  I  D  A  Y

10403S      3901 TAAAATTAGATGGGGTGAAGTGATGAATATTAGTATAGAAATAAAAGAACGTGATACTGACCACATAGACATATTTGTTGCTGGGGAGATCGATGCTTAT

                                        M  N  I  S  I  E  I  K  E  R  D  T  D  H  I  D  I  F  V  A  G  E  I  D  A  Y

 

 


F2365       3999 ACAGCGCCAAAGGTAAAAGAAGCACTTGAAGTATATCAAGTAAAAGAGGGTATAGTACTTCGAATCGATTTAACAGAAGTAAGTTATATGGATAGTACCG

                  T  A  P  K  V  K  E  A  L  E  V  Y  Q  V  K  E  G  I  V  L  R  I  D  L  T  E  V  S  Y  M  D  S  T 

J1-194      3999 ACAGCGCCAAAGGTAAAAGAAGCACTTGAAGTATATCAAGTAAAAGAGGGTATAGTACTTCGAATCGATTTAACAGAAGTAAGTTATATGGATAGTACCG

                  T  A  P  K  V  K  E  A  L  E  V  Y  Q  V  K  E  G  I  V  L  R  I  D  L  T  E  V  S  Y  M  D  S  T

10403S      4001 ACAGCGCCAAAGGTAAAAGAAGCATTAGAAGTATATCAAGTTAAAGAGGGTATTGTACTTCGGATCGATTTAACAGAAGTGAGTTACATGGATAGCACCG

                  T  A  P  K  V  K  E  A  L  E  V  Y  Q  V  K  E  G  I  V  L  R  I  D  L  T  E  V  S  Y  M  D  S  T 

 

 


F2365       4099 GATTAGGCGTATTTGTAGGAGCGTTTAAAAGCTTACGTCAACGCCAAAGTGAACTTGTCTTGTTTGGTTTAAGCGACCGACTTTTCCGATTGTTTGAAAT

                 G  L  G  V  F  V  G  A  F  K  S  L  R  Q  R  Q  S  E  L  V  L  F  G  L  S  D  R  L  F  R  L  F  E  I

J1-194      4099 GATTAGGCGTATTTGTAGGAGCGTTTAAAAGCTTACGTCAACGCCAAAGTGAACTTGTCTTGTTTGGTTTAAGCGACCGACTTTTCCGATTGTTTGAAAT

                 G  L  G  V  F  V  G  A  F  K  S  L  R  Q  R  Q  S  E  L  V  L  F  G  L  S  D  R  L  F  R  L  F  E  I

10403S      4101 GATTAGGCGTATTTGTAGGAGCTTTCAAAAGCTTACGTCAACGCCAAAGTGAACTTGTCTTGTTTGGTTTAAGCGACCGACTTTTCCGATTGTTTGAAAT

                 G  L  G  V  F  V  G  A  F  K  S  L  R  Q  R  Q  S  E  L  V  L  F  G  L  S  D  R  L  F  R  L  F  E  I

 

 


                                                              rsbW

F2365       4199 CACAGGATTGTCAGATATCATTGAAATCAAAAATGTAGAGGGTGAAATGAATGGCAACAATGCATGACAAAATTACATTACAACTTCCTGCCAAGCCTGA

                   T  G  L  S  D  I  I  E  I  K  N  V  E  G  E  M  N  G  N  N  A  * 

                                                                    M  A  T  M  H  D  K  I  T  L  Q  L  P  A  K  P  E

J1-194      4199 CACAGGATTGTCAGATATCATTGAAATCAAAAATGTAGAGGGTGAAATGAATGGCAACAATGCATGACAAAATTACATTACAACTTCCTGCCAAGCCTGA

                   T  G  L  S  D  I  I  E  I  K  N  V  E  G  E  M  N  G  N  N  A  *

                                                                    M  A  T  M  H  D  K  I  T  L  Q  L  P  A  K  P  E

10403S      4201 CACAGGATTGTCAGATATCATCGAAATCAAAAATGTAGAGGGTGAAATGAATGGCAACAATGCATGACAAAATTACATTACAACTTCCTGCCAAGCCTGA

                   T  G  L  S  D  I  I  E  I  K  N  V  E  G  E  M  N  G  N  N  A  * 

                                                                    M  A  T  M  H  D  K  I  T  L  Q  L  P  A  K  P  E

 

 


F2365       4299 ATATGTTAGTTTAGGTAGACTTTCATTATCAGGAATTGCAAGTCGCGCAGGATTTTCTTATGAAGCAATTGAAGATTTGAAAATAGCCGTAAGTGAAGCC

                   Y  V  S  L  G  R  L  S  L  S  G  I  A  S  R  A  G  F  S  Y  E  A  I  E  D  L  K  I  A  V  S  E  A

J1-194      4299 ATATGTTAGTTTAGGTAGACTTTCATTATCAGGAATTGCAAGTCGCGCAGGATTTTCTTATGAAGCAATTGAAGATTTGAAAATAGCCGTAAGTGAAGCC

                   Y  V  S  L  G  R  L  S  L  S  G  I  A  S  R  A  G  F  S  Y  E  A  I  E  D  L  K  I  A  V  S  E  A

10403S      4301 ATATGTAAGTTTAGGTAGACTTTCATTATCAGGAATTGCAAGTCGCGCAGGATTTTCTTATGAAGCAATTGAAGATTTGAAAATAGCTGTAAGTGAAGCC

                   Y  V  S  L  G  R  L  S  L  S  G  I  A  S  R  A  G  F  S  Y  E  A  I  E  D  L  K  I  A  V  S  E  A 

 

 


F2365       4399 ATCACTAATTCTGTAAAGCACGCATTTAAAGGAGAAGATGATGGTGAGATTACAGTAGAATATCTTATTTATGAAGACAAATTAGAAGTTCGTGTTTCTG

                  I  T  N  S  V  K  H  A  F  K  G  E  D  D  G  E  I  T  V  E  Y  L  I  Y  E  D  K  L  E  V  R  V  S

J1-194      4399 ATCACTAATTCTGTAAAGCACGCATTTAAAGGAGAAGATGATGGTGAGATTACAGTAGAATATCTTATTTATGAAGACAAATTAGAAGTTCGTGTTTCTG

                  I  T  N  S  V  K  H  A  F  K  G  E  D  D  G  E  I  T  V  E  Y  L  I  Y  E  D  K  L  E  V  R  V  S

10403S      4401 ATCACTAATTCCGTAAAGCATGCATTTAAAGGGGAAGAAGATGGCGAGATCACAGTCGAATATCTTATTTATGAAGATAAGCTAGAAGTTCGTGTTTCCG

                  I  T  N  S  V  K  H  A  F  K  G  E  E  D  G  E  I  T  V  E  Y  L  I  Y  E  D  K  L  E  V  R  V  S

 

 


F2365       4499 ATAATGGAACAAGCTTCGACTTAGAAACCCGTAAACAAGAAATTGGCCCATATGAGGTAGGGGAAGATGCGGAGATGATGCGTATCGGAGGTCTAGGTTT

                 D  N  G  T  S  F  D  L  E  T  R  K  Q  E  I  G  P  Y  E  V  G  E  D  A  E  M  M  R  I  G  G  L  G  L

J1-194      4499 ATAATGGAACAAGCTTCGACTTAGAAACCCGTAAACAAGAAATTGGCCCATATGAGGTAGGGGAAGATGCGGAGATGATGCGTATCGGAGGTCTAGGTTT

                 D  N  G  T  S  F  D  L  E  T  R  K  Q  E  I  G  P  Y  E  V  G  E  D  A  E  M  M  R  I  G  G  L  G  L

10403S      4501 ATAACGGCACAAGCTTCGACTTAGAAACCCGTAAACAAGAAATTGGCCCATATGATGTGGGCGAGGATGCGGAGATGATGCGTATCGGTGGGCTAGGTTT

                 D  N  G  T  S  F  D  L  E  T  R  K  Q  E  I  G  P  Y  D  V  G  E  D  A  E  M  M  R  I  G  G  L  G  L

 

 


F2365       4599 ATTTTTAATTGAAACATTAATGGATGACGTGAAACTTTATTATGATGAAGGGGTTTCTGTCGTAATGACCAAATATATTAATGAAAAGCAGGTGGAGGAG

                   F  L  I  E  T  L  M  D  D  V  K  L  Y  Y  D  E  G  V  S  V  V  M  T  K  Y  I  N  E  K  Q  V  E  E

J1-194      4599 ATTTTTAATTGAAACATTAATGGATGACGTGAAACTTTATTATGATGAAGGGGTTTCTGTCGTAATGACCAAATATATTAATGAAAAGCAGGTGGAGGAG

                   F  L  I  E  T  L  M  D  D  V  K  L  Y  Y  D  E  G  V  S  V  V  M  T  K  Y  I  N  E  K  Q  V  E  E

10403S      4601 ATTTTTAATTGAAACATTAATGGATGACGTGAAACTTTATTATGATGAAGGGGTTTCTGTCGTAATGACCAAATATATTAATGAAAAGCAGGTGGAGGAG

                   F  L  I  E  T  L  M  D  D  V  K  L  Y  Y  D  E  G  V  S  V  V  M  T  K  Y  I  N  E  K  Q  V  E  E

 

 

 


             sigB

F2365       4699 AATGCCAAAAGTATCTCAACCTGATAAAGAGGCGAAAGAAAAAGTCTATATATGGATTGCCGCTTACCAAGAAAATGGCGATCAAGACGCCCAATATAAT

                  N  A  K  S  I  S  T  * 

                   M  P  K  V  S  Q  P  D  K  E  A  K  E  K  V  Y  I  W  I  A  A  Y  Q  E  N  G  D  Q  D  A  Q  Y  N

J1-194      4699 AATGCCAAAAGTATCTCAACCTGATAAAGAGGCGAAAGAAAAAGTCTATATATGGATTGCCGCTTACCAAGAAAATGGCGATCAAGACGCCCAATATAAT

                  N  A  K  S  I  S  T  * 

                   M  P  K  V  S  Q  P  D  K  E  A  K  E  K  V  Y  I  W  I  A  A  Y  Q  E  N  G  D  Q  D  A  Q  Y  N

10403S      4701 AATGCCAAAAGTATCTCAACCTGATAAAGAGGCGAAAGAAAAAGTCTATATTTGGATTGCCGCTTACCAAGAAAATGGCGATCAAGACGCCCAATATAAT

                  N  A  K  S  I  S  T  *

                   M  P  K  V  S  Q  P  D  K  E  A  K  E  K  V  Y  I  W  I  A  A  Y  Q  E  N  G  D  Q  D  A  Q  Y  N

 

 


F2365       4799 TTAGTTGTTCATTACAAAAACCTAGTAGAGTCTATTGCTCGCAAATATTCCCAAGGTAAATCTTTTCATGAAGATTTAGTTCAAGTTGGAAATATTGGCT

                  L  V  V  H  Y  K  N  L  V  E  S  I  A  R  K  Y  S  Q  G  K  S  F  H  E  D  L  V  Q  V  G  N  I  G 

J1-194      4799 TTAGTTGTTCATTACAAAAACCTAGTAGAGTCTATTGCTCGCAAATATTCCCAAGGTAAATCTTTTCATGAAGATTTAGTTCAAGTTGGAAATATTGGCT

                  L  V  V  H  Y  K  N  L  V  E  S  I  A  R  K  Y  S  Q  G  K  S  F  H  E  D  L  V  Q  V  G  N  I  G 

10403S      4801 TTAGTTGTTCATTACAAAAACCTAGTAGAGTCCATCGCCCGAAAATATTCCCAAGGTAAATCTTTTCATGAAGATTTAGTTCAAGTTGGGAATATTGGTT

                  L  V  V  H  Y  K  N  L  V  E  S  I  A  R  K  Y  S  Q  G  K  S  F  H  E  D  L  V  Q  V  G  N  I  G

 

 


F2365       4899 TACTTGGAGCTATTAGAAGATATGATGCGACGTTTGGGAAAAGCTTTGAAGCATTTGCTGTACCAACCATTGTTGGCGAAATTAAACGATTTTTACGTGA

                 L  L  G  A  I  R  R  Y  D  A  T  F  G  K  S  F  E  A  F  A  V  P  T  I  V  G  E  I  K  R  F  L  R  D

J1-194      4899 TACTTGGAGCTATTAGAAGATATGATGCGACGTTTGGGAAAAGCTTTGAAGCATTTGCTGTACCAACCATTGTTGGCGAAATTAAACGATTTTTACGTGA

                 L  L  G  A  I  R  R  Y  D  A  T  F  G  K  S  F  E  A  F  A  V  P  T  I  V  G  E  I  K  R  F  L  R  D

10403S      4901 TACTTGGAGCTATTAGAAGATATGATGCAACGTTTGGAAAAAGCTTTGAAGCATTTGCTGTGCCAACAATTGTTGGTGAAATCAAACGGTTTTTACGTGA

                 L  L  G  A  I  R  R  Y  D  A  T  F  G  K  S  F  E  A  F  A  V  P  T  I  V  G  E  I  K  R  F  L  R  D

 

 


F2365       4999 TAAAACATGGAGTGTGCATGTGCCGCGCCGAATCAAAGAATTAGGTCCGAAAATTAAAAATGCCGTAGAAGAGCTGACGAGAGAATTACAAAGCTCGCCG

                   K  T  W  S  V  H  V  P  R  R  I  K  E  L  G  P  K  I  K  N  A  V  E  E  L  T  R  E  L  Q  S  S  P

J1-194      4999 TAAAACATGGAGTGTGCATGTGCCGCGCCGAATCAAAGAATTAGGTCCGAAAATTAAAAATGCCGTAGAAGAGCTGACGAGAGAACTACAAAGCTCGCCG

                   K  T  W  S  V  H  V  P  R  R  I  K  E  L  G  P  K  I  K  N  A  V  E  E  L  T  R  E  L  Q  S  S  P

10403S      5001 TAAAACATGGAGTGTCCATGTGCCGCGCCGAATCAAAGAGTTAGGTCCGAAAATCAAAAATGCCGTAGAAGAGCTAACGAGAGAACTTCAAAGCTCGCCG

                   K  T  W  S  V  H  V  P  R  R  I  K  E  L  G  P  K  I  K  N  A  V  E  E  L  T  R  E  L  Q  S  S  P

 

 


F2365       5099 CAAATTAGCGACATTGCTGATTTCATCGGTGTCACGGAAGAAGAAGTTTTAGAAGCAATGGAGATGGGAAAAAGCTACCAAGCGCTTTCTGTAGATCATT

                  Q  I  S  D  I  A  D  F  I  G  V  T  E  E  E  V  L  E  A  M  E  M  G  K  S  Y  Q  A  L  S  V  D  H

J1-194      5099 CAAATTAGCGACATTGCTGATTTCATCGGTGTCACGGAAGAAGAAGTTTTAGAAGCAATGGAGATGGGAAAAAGCTACCAAGCGCTTTCTGTAGATCATT

                  Q  I  S  D  I  A  D  F  I  G  V  T  E  E  E  V  L  E  A  M  E  M  G  K  S  Y  Q  A  L  S  V  D  H

10403S      5101 CAAATTAGCGACATTGCTGATTTTATTGGTGTCACGGAAGAAGAAGTTTTAGAAGCAATGGAAATGGGAAAAAGCTACCAAGCACTTTCTGTAGATCATT

                  Q  I  S  D  I  A  D  F  I  G  V  T  E  E  E  V  L  E  A  M  E  M  G  K  S  Y  Q  A  L  S  V  D  H

 

 


F2365       5199 CGATTGAAGCTGATTCGGATGGAAGTACAATTACCTTATTAGATGTTGTTGGTGGTACGGATGATGGATTTGAACGTGTGAATCAACGTATGCTCTTAGA

                 S  I  E  A  D  S  D  G  S  T  I  T  L  L  D  V  V  G  G  T  D  D  G  F  E  R  V  N  Q  R  M  L  L  E

J1-194      5199 CGATTGAAGCTGATTCGGATGGAAGTACGATTACCTTACTAGATGTTGTTGGTGGTACGGATGATGGATTTGAACGTGTGAATCAACGTATGCTCTTAGA

                 S  I  E  A  D  S  D  G  S  T  I  T  L  L  D  V  V  G  G  T  D  D  G  F  E  R  V  N  Q  R  M  L  L  E

10403S      5201 CGATTGAAGCTGATTCGGATGGAAGTACGATTACGTTACTTGATGTTGTTGGTGGTACGGATGATGGATTTGAACGTGTGAATCAACGTATGCTCTTAGA

                 S  I  E  A  D  S  D  G  S  T  I  T  L  L  D  V  V  G  G  T  D  D  G  F  E  R  V  N  Q  R  M  L  L  E

 

 


F2365       5299 GAAAGTTCTCCCTGTTTTAGATGAGCGAGAACAGAAGATTTTGCAATTTACATTTATTGAAAATCGCAGTCAAAAAGAAACGGGTGAACTACTCGATATA

                   K  V  L  P  V  L  D  E  R  E  Q  K  I  L  Q  F  T  F  I  E  N  R  S  Q  K  E  T  G  E  L  L  D  I

J1-194      5299 GAAAGTTCTCCCTGTTTTAGATGAGCGAGAACAGAAGATTTTGCAATTTACATTTATTGAAAATCGCAGTCAAAAAGAAACGGGTGAACTACTCGATATA

                   K  V  L  P  V  L  D  E  R  E  Q  K  I  L  Q  F  T  F  I  E  N  R  S  Q  K  E  T  G  E  L  L  D  I

10403S      5301 GAAAGTTCTCCCTGTTTTAGATGAGCGAGAACAGAAGATTTTGCAATATACATTTATTGAAAATCGCAGTCAAAAAGAAACGGGTGAACTACTCGATATA

                   K  V  L  P  V  L  D  E  R  E  Q  K  I  L  Q  Y  T  F  I  E  N  R  S  Q  K  E  T  G  E  L  L  D  I

 

                                                                                                  rsbX

 


F2365       5399 TCACAAATGCATGTGTCTAGAATCCAACGTCAAGCTATTAAAAAACTTCGAGAGGCGTTGCAGAATGAGGAAGTGGAGTAAATGAACAAGGCAGTTGAAT

                  S  Q  M  H  V  S  R  I  Q  R  Q  A  I  K  K  L  R  E  A  L  Q  N  E  E  V  E  *  M  N  K  A  V  E 

J1-194      5399 TCACAAATGCATGTGTCTAGAATCCAACGTCAAGCTATTAAAAAACTTCGAGAGGCGTTGCAGAATGAGGAAGTGGAGTAAATGAACAAGGCAGTTGAAT

                  S  Q  M  H  V  S  R  I  Q  R  Q  A  I  K  K  L  R  E  A  L  Q  N  E  E  V  E  *  M  N  K  A  V  E  

10403S      5401 TCACAAATGCATGTGTCTAGAATCCAACGTCAAGCTATTAAAAAACTTCGAGAGGCGTTGCAGAATGAGGAAGTGGAGTAAATGAACAAGGCAGTTGAAT

                  S  Q  M  H  V  S  R  I  Q  R  Q  A  I  K  K  L  R  E  A  L  Q  N  E  E  V  E  *  M  N  K  A  V  E

 

 


F2365       5499 CAAATAATTTATTTGTATTTCAACGTTCTAAAGCATTACAACAATACTGCGGGGATGTTTATTATACCCATGAAGACGAAAATGGTTTTCTGTATGTTCT

                 S  N  N  L  F  V  F  Q  R  S  K  A  L  Q  Q  Y  C  G  D  V  Y  Y  T  H  E  D  E  N  G  F  L  Y  V  L

J1-194      5499 CAAATAATTTATTTGTATTTCAACGTTCTAAAGCATTACAACAATACTGCGGGGATGTTTATTATACCCATGAAGACGAAAATGGTTTTCTGTATGTTCT

                 S  N  N  L  F  V  F  Q  R  S  K  A  L  Q  Q  Y  C  G  D  V  Y  Y  T  H  E  D  E  N  G  F  L  Y  V  L

10403S      5501 CAAATAATTTATTTGTATTTCAACGTTCTAAAGCATTACAACAATACTGCGGGGATGTTTATTATACCCATGAAGACGAAAATGGTTTTCTGTATGTTCT

                 S  N  N  L  F  V  F  Q  R  S  K  A  L  Q  Q  Y  C  G  D  V  Y  Y  T  H  E  D  E  N  G  F  L  Y  V  L

 

 


F2365       5599 TTCTGATGGACTTGGAAGCGGGCTCGAAGCTAATAGAGCTGCCAAAGCGACCGTTGATGCCATAAAAGAGGATATCCATGCAGATATTACCGATATGCTC

                   S  D  G  L  G  S  G  L  E  A  N  R  A  A  K  A  T  V  D  A  I  K  E  D  I  H  A  D  I  T  D  M  L

J1-194      5599 TTCTGATGGACTTGGAAGCGGGCTCGAAGCTAATAGAGCTGCCAAAGCGACCGTTGATGCCATAAAAGAGGATATCCATGCAGATATTACCGATATGCTC

                   S  D  G  L  G  S  G  L  E  A  N  R  A  A  K  A  T  V  D  A  I  K  E  D  I  H  A  D  I  T  D  M  L

10403S      5601 TTCTGATGGACTTGGAAGTGGGCTCGAAGCTAATAGAGCGGCCAAAGCGACTGTTGACGCCATAAAAGAAGATATTCATGCAGATATTACTGATATGCTT

                   S  D  G  L  G  S  G  L  E  A  N  R  A  A  K  A  T  V  D  A  I  K  E  D  I  H  A  D  I  T  D  M  L

 

 


F2365       5699 GAAAAAGCGAACCAGGCTGTTTCAGGACTTCGAGGTGCTGCGATAGCTATTATTAAAGGTGACTACTTAACGAAGACCCTTTATTATACTGGTATGGGTA

                  E  K  A  N  Q  A  V  S  G  L  R  G  A  A  I  A  I  I  K  G  D  Y  L  T  K  T  L  Y  Y  T  G  M  G 

J1-194      5699 GAAAAAGCGAACCAGGCTGTTTCAGGACTTCGAGGTGCTGCGATAGCTATTATTAAAGGTGACTACTTAACGAAGACCCTTTATTATACTGGTATGGGTA

                  E  K  A  N  Q  A  V  S  G  L  R  G  A  A  I  A  I  I  K  G  D  Y  L  T  K  T  L  Y  Y  T  G  M  G

10403S      5701 GAAAAAGCGAACCAGGCTGTTTCAGGGCTTCGTGGTGCTGCGATAGCTATTATTAAAGGTGACTACTTAACGAAGACACTTTATTATACTGGTATGGGTA

                  E  K  A  N  Q  A  V  S  G  L  R  G  A  A  I  A  I  I  K  G  D  Y  L  T  K  T  L  Y  Y  T  G  M  G

 

 


F2365       5799 ATATTCGTTTTTATATGATTGGGATGGAAGATAAGCTTATTTTTCCGCTTTCTGGCTCTGGATTTTTGTCCGGTCGAAAACAGAAATATCGGTTGCAATC

                 N  I  R  F  Y  M  I  G  M  E  D  K  L  I  F  P  L  S  G  S  G  F  L  S  G  R  K  Q  K  Y  R  L  Q  S

J1-194      5799 ATATTCGTTTTTATATGATTGGGATGGAAGATAAGCTTATTTTTCCGCTTTCTGGCTCTGGATTTTTGTCCGGTCGAAAACAGAAATATCGGTTGCAATC

                 N  I  R  F  Y  M  I  G  M  E  D  K  L  I  F  P  L  S  G  S  G  F  L  S  G  R  K  Q  K  Y  R  L  Q  S

10403S      5801 ATATTCGTTTTTATATGATTGGGATTGAAGATAAGCTTATTTTTCCGCTTTCAGGCTCTGGATTTTTGTCCGGTCGAAAACAGAAATATCGGTTGCAATC

                 N  I  R  F  Y  M  I  G  I  E  D  K  L  I  F  P  L  S  G  S  G  F  L  S  G  R  K  Q  K  Y  R  L  Q  S

 

 


F2365       5899 GTTTAAATATAAACCAGGCAGTAAGTTTTTAATGCATTCAGATGGACTTGTTCTTTCTCGCGTTAGAAAAAGCCTAGAATCGCCACTTTGTGTAGTGAAA

                   F  K  Y  K  P  G  S  K  F  L  M  H  S  D  G  L  V  L  S  R  V  R  K  S  L  E  S  P  L  C  V  V  K

J1-194      5899 GTTTAAATATAAACCAGGCAGTAAGTTTTTAATGCATTCAGATGGACTTGTTCTTTCTCGCGTTAGAAAAAGCCTAGAATCGCCACTTTGTGTAGTGAAA

                   F  K  Y  K  P  G  S  K  F  L  M  H  S  D  G  L  V  L  S  R  V  R  K  S  L  E  S  P  L  C  V  V  K

10403S      5901 GTTTAAATATAAACCAGGCAGTAAGTTTTTAATGCATTCAGATGGACTTGTTCTTTCTCGCGTTAGAAAAAGCCTAGAATCACCACTTTGTGTAGTGAAA

                   F  K  Y  K  P  G  S  K  F  L  M  H  S  D  G  L  V  L  S  R  V  R  K  S  L  E  S  P  L  C  V  V  K

 

                                                                                                        transcription

F2365       5999 ATCGGGCATTTAATCGAGCGTAATATATTAGATATTCCAACAGATGATGTTACTTTTATGGTTGGGAAATTTCCGGAATAACAAAAACACCTTTTAAATG

                  I  G  H  L  I  E  R  N  I  L  D  I  P  T  D  D  V  T  F  M  V  G  K  F  P  E  *

J1-194      5999 ATCGGGCATTTAATCGAGCGTAATATATTAGATATTCCAACAGATGATGTTACTTTTATGGTTGGGAAATTTCCGGAATAACAAAAACACCTTTTAAATG

                  I  G  H  L  I  E  R  N  I  L  D  I  P  T  D  D  V  T  F  M  V  G  K  F  P  E  *

10403S      6001 ATCGGGCATTTAATCGAGCGTAATATATTAGATATTCCAACAGATGATGTAACTTTTATGGTTGGGAAATTTCCGGAATAACAAAAACACCTTTTAAACG

                  I  G  H  L  I  E  R  N  I  L  D  I  P  T  D  D  V  T  F  M  V  G  K  F  P  E  * 

 

                  terminator

F2365       6099 ATTCCTAGTTTAAAAGGTGTTTTTT

                  

J1-194      6099 ATTCCTAGTTTAAAAGGTGTTTTTT

                  

10403S      6101 TTTGCTAGTTTAAAAGGTGTTTTTT

                

 

 

 

Supplemental Figure 1. Nucleotide sequence alignment of the rsb operon and two upstream genes from F2365, FSL J1-194 and 10403S. The two upstream genes LMOf2365_0906 and LMOf2365_0907 were included because no rho-independent transcription terminator was identified between LMOf2365_0907 and rsbR suggesting that a run-through transcript may encode these two upstream genes within the rsb genes. Coding regions are indicated by colored bars above the alignment. Promoter regions and transcription start were identified based on unpublished RNA sequencing data (Orsi et al., in preparation).  The -35 and -10 promoter regions are colored in red and underlined. Transcription start sites are underlined and indicated by a "+1" above them. The rho-independent transcription terminator downstream rsbX is indicated and underlined. Start codons are colored in red. Stop codon are indicated by the symbol "*". The exact location of the transcription start site upstream rsbV was not unequivocally identified and, therefore is not marked. The -35 and -10 promoter regions upstream rsbR were not unequivocally identified and, therefore are not shown. Mismatches in the nucleotide and amino acid sequences are shaded in gray.